OCR Text |
Show tgooaoaaaaaaaaaauuuuuuuaga Sunday DECEMBER 13. 1M1 MORMNG 600 O MOVC "Ow-oke- e O EXTRA TMS WEEK WITH OAVSBRKKLEY TMS WEEK ON WALL STREET 10:30 Flash" ( 1046. Western) Sunset Carton. A reformed crook pete imps-cala- d In killing through the kilkioncn ol hit old CJ . 0NFLTOOAY PiSCCTWNFL crorwaa 0QOOO 88 B8 NEWS CENTER ELECTRIC COMPANY (R) COLLEGE FOOTBALL "Garden State Boat" Tannaaaaa va. m SPORTS 6:26 6:30 6:36 8 8 new wave tkatre SUPERMAN JAMES ROBISON MOVC 'Sunday QE1 Lovara" (1081. Romanca) TIC DEAF ICAR (T6 BEST OP 0 8 IIOOU 8CCNCE M CULTURE ffi OTHER THE COM O ffi AGRI- BASKET- Vagaa 8 at CaMormalnma 0PWWHEEI 0 TRILOGY: 8 Lags' Huach" 8"Wagon THREE CLASSIC TALES SOS OFath 20 TWEE STOOGES AND FRCNOS 0 BUYER'S FORUM 8:15 8:30 11 ffi WHAT DO YOU WANT TO BE WHEN YOU GROW OLD? TO BE ANNOUNCED S TWEE SCORE COMMUMTY CALENDAR WHAT'S NU? 8:48 SACRED HEART 700 I OCX) LET'S FACE IT KENNETH COPELANO FACES 9 (D JM BANKER SUNOAY MASS LOST M8PACE 706 FROM TtC CATHE7:16 DRAL JERRY FALWELL 7:30 Cl LANO OF THE LOST O MATT ANO JENNY Tram Waal" A man and hta daughter tel Matt tua relatives are with the wagon tram that latt them behind. MOVC "Sherlock In Washington Holmes H "The MOVC 1106 Grass Is Greener" (1961, 8 1 Glaaa Q9 SHORTS BLOCK CHICAGOLAND 03 8RAINBOW 8 O O 12.008 WORLD COUSTEAU O (9 LANO 88 8 Glass 0 806 8:30 n ffl (J TOO Guaata: Danielle Briaeboia, actor Douglaa Sheehan, comedianna Joy Bahar. gadget expart Stan Kann. (R) RELIGIOUS 12:30 ACADEMY Passing" Knight. 8ERGEANT PRESTON OF THE YUKON MOVIE "Kisses 8:36 For 900 My President" (1964. THE B TOMORROW O O JIMMY SWAG-GAR- T TARZAN BUSINESS JOUR0:30 Cl NAL Cl IT IS WRITTEN TABERNACLE CHOIR STEPPING OUT: THE DEBOLTS GROW UP 0 (J PLUS MOVIE To FITNESS MOTIVA- TION CISCO KID A Figg" (1971. Comedy) Don Knotts, Joe Flynn. An innocent victim gets the best of his adversaries with the help of a computer. ZOLA LEVITT MOVIE B 8 BYU DEVOTIONAL ARCHIVES 8Sixty" (Comedy)"Zero 69 8 8 fl O To Frame U NEWSIGHT'81 B8 ffi For ' Glass" (1980, B 8 "Breaking Drama) WALL STREET WEEK "More Bullish Than Most?" Guest: Joseph J. McAlinden, president and chief executive officer, Argus Research Corporation. (R) (D (ED THIS IS THE LIFE 8 UVEWIRE "Ripoffs" responsible (1956, B Broadway" 8 69 8"Songs Inspired ONLY 7:06 7:10 MASTERPIECE "Edward And DeterMrs. Simpson" mined to marry Mrs. Simptha tells his son, King mother and sister of his love for her. (Part 5) Q SPORTS CENTER THE LONG SEARCH Loose Ends" BIM'A'S'H o8 SURVIVAL GYMNASTICS "USGF Single Elimination Championships" Tim Daggetl e vs. Mitch Gaylord and ffi Host Ronald Eyre lakes stock of his own attitudes in light of the series. 88 9:06 0:20 0:30 vs. AMERICA SINGS THE TOMORROW PEOPLE "The Slaves Of Jedikiah" The Tomorrow People, desperate to rescue Kenny, jaunt into the spaceship - all but Carol. (Part 5) LITTLE HOUSE ON 69 THE PRAIRE Paintings: 's 8 8 Remembered" Maxim Mazumdar in a one-ma- n play about the life ol Oscar Wilde. PUBLIC ENEMIES SPORTS PROBE MOVE "lr 8:00 Search Of Historic Jesus' 7:30 8B John Drama) Rubinstein. Nehemiah Per (1979, 8 8 08 lypse Now" O 8 FIRING LINE What Is There To Leant From The Killing Of Dr. Guest: Diana author ot "Mrs. Trilling, Harris." TENNIS "Davis Cup Finals: Singles Match D" from Cincinnati, Ohio. B 8 MARKET TO KET (R) 8 Cut" MOVIE 10:30 il B MAR- "Rough Adventure) (1980, 10:160 ffi NEWS TAKE TWO SNEAK PREVIEWS 8 Roger Ebert Siskel and review "My Dinner Gene "Reds," With Andre" and Montenegro." 8 COLLEGE BASKETBALL American University vs. Georgetown Nude Against The Light' '' With art historian Edwin Mullins. MAN ANO WOMAN 7:20 WITH TAMMY GRIMES AND JERRY ORBACH "Oscar CONTACT 69 KUNG FU Came finds himself caught in a trap set by a beautiful woman. CARIBBEAN NIGHTS MAN AND WOMAN WITH TAMMY GRIMES AND JERRY ORBACH COLLEGE FOOTBALL INDEPENDENT 69 NETWORK NEWS OPEN UP NEWS ffi MOVIE fr fr "Apoca- 0:36 10:00 O By Great 8 "Great 8 B WELK MAN ANO WOMAN WITH TAMMY GRIMES AND JERRY ORBACH pute between Presidenl Reagan's Secretary of the Intenor James Watt and environmentalists over America's test untouched tend MOVIE 10:36 Giant" 89 8 (1933, 8 11:46 ffi 8 SHOW 11:00Q MOVIE Newman's Law (1974, Drama) George Peppard, Roger Robinson. An honest cop wages a battle PeoScien- Peter ce-Fiction) Graves, Vema Bloom. After most of Earth's population is destroyed by radiation, the survivors a struggle lo live. 12:00 MOVC "The Fifth Floor" (I960. Drama) Bo Hull. A lhanne Hopkins, young woman is incarcerated in a bizarre mental hospital where violence and drug abuse are the order of the day. 'R' 8 1206 8 NEWS ffi MOVC "Twenty Million Sweethearts" PowDick (1934. Musical) ell. Ginger Rogers. A young man's marriage is threatened by his career and an overzealous agent. H "Bear MOVC 12:30 Island" (I960) Donald Sutherland, Redgrave. Vanessa An weather-researc- Arctic team's mind isn't just on the climate when Hs members are forced into a tight for their very survival. 'PG' ROOEO 5? HEAL THREAT 12:460 BUSINESS JOUR- NAL 1:00 ffi SPORTS CENTER 0 1:160 CROMC CIRCLE GET SMART H seems that every man Max picks as his best man meets with a mysterious accident. 1:30 O ffi ABC NEWS O 8 NEWS ffl GYMNASTICS "USGF Single Elimination Championships" Tim Daggett vs. Mitch Gaylord and JulMacNamara vs. ianna Becky Rashoff MOVC "Why Would I Lie?" (1980, Comedy) Treat Williams. Lisa Eichhorn. A compulsive liar upsets the status quo with his refusal to conform. 'PG' MOVC "Cain And 2:00 Mabel" (1936, Comedy) Clark Gable. Marion Davies. A prizefighter and a showgirl clash over a publicity stunt. STEPPING OUT: THE 2:16 DEBOLTS GROW UP This sequel to the popular special "Who Are The DeBolts And Where Did They Get 19 Kids?" updates the story of the extraordinary family which now includes 20 ped children. 2:30 ffl COLLEGE BASKETBALL Nevada-La- s Vegas at Califomia-lrvin- e 0 80 Glass SPEEDWAY MOVC "The Menagerie" (1950, Drama) Jane Wyman, Kirk Douglas. Based on the play by Tennessee Wi- EVENING AT THE CBS NEWS SATURDAY NIGHT BYU COACH'S JIM BAKKER AH Drama) 8 O8 8 MOVIE 0Where Have The ple Goner' (1974. ti "Little Charles Fleisher, Bobby Paul Provenza, Kelton, McDonald, Dale Kelly Gonyoa. MOVIE "Con flict" (1945, Mystery) JACK VAN MPE MOVC 4 "The Silver Chalice (1955, Drama) Paul Newman, VirA young ginia Mayo. Greek designs the Last chalice Supper SNEAK PREVCWS 1t:30Q Roger Ebert and Gene Siskel review "Reds," "My Dinner With Andre" and "Montenegro " (R) IMPROV Host: Steve Allen. Featured comics: 10:46 O 10:50 O a investigated 8 1106 0 8 69 THEATRE a ffi ATLANTIC CITY AUVE 8 THE ENVIRONMENT: PROMISEO LANO The dis- 8 O Classics" NATIONAL 8 -- LAWRENCE MCE PEOPLE BITER THE ffi Christmas Carol" (1938, Fantasy) Reginald Owen, 6O0GNEWS B8 8 move WOMAN GRIMES ORBACH KBfG IS COMING ROOM STANDING 9:00 AND WOMAN WITH TAMMY GRIMES AND JERRY ORBACH is pressed into service as a substitute teacher when Miss Beadle breaks a leg. ANO TAMMY MAN look at the jazz worlds female vocalists (Part 3) MAN "Tarantella" The New York City Ballet featuring Edward Villella and Patricia McBride. MYSTERY WITH ANO JERRY "Yesterday And Today" A B8B8 8 MacNamara Becky Rashoff 6:608 and others are featured, MOVIE "Adam's Rib" (1949. COSMOS 8 joy8 the mostBernard Hughes and Justin Henry host a Christmas apecial dedicated to the tamilaa of the world. ffi Phyllis Diller. LITTLE HOUSE ON THE PRAIRE Mrs. Ingalls ABC NEWS O ffi PRIORITY ONE r. B8 Scienc- 8 4:36 a for AMERICAN TRAIL PARTY FOR BURT REYNOLDS Variety Clubs International presenta a apecial celebrity tribute to entertainer Burt Reynolds; appearances by Loni Anderson, Dorn DeLuise, Kris Jack Lemmon (1980) HANUKKAH Ed Asner explains the significance of the religious holiday. 8TU0I0 SEE "Last Show" A behind-the-scene- s look is taken at how TV is planned, produced and broadcast; two seasons of Studio See are AND WELLI SHOP SMITH "How MOVC case and starts harassing a man he believes to be CENTER BO SCHEMBECHLER "Headin' MOVC 4:30 - Jedikiah" 1:30 TODAY'S FBI Nick O becomes too involved in a e-Fiction) CUL- THE TOMORROW PEOPLE "The Slaves Of B 8 SESAME STREET (R)g MEET THE PRESS 10:00 B ORAL ROBERTS FACE THE NATION SPORTS CENTER 3den Planet" ful burglary. Bt SEARCH OF... THE PHOTO SHOW WHAT WU THEY THfrfK OF NEXT? PEOPLE TO PEOPLE "Forbid- MOVIE 69 S CUPS Jon end Ponch investigate a scheme to skim profits from the auction of rare antique autos. NEWS NEWS JOHN ANKERBERQ ENGLISH CHANNEL Australian Ark: Return To The Dreaming" "The Lady And The Cowboy" 88 6:30 O 8 8 7:00 B B 8 MUSIC AND THE SPOKEN WORD 8 ALIVE W0N0ER WOMAN Wonder Woman races against time to capture an enemy agent infected with the bubonic plague and armed with a secret formula that could destroy the United States. MYSTER-E- Kramer" 8"The Nancy is determined to restore the honor of a dear old gentleman who claims to be Santa Claus when he ia accused of PLUS 8th Notes" 88 O ffl SPORTS E.J. DANIELS B8 WRESTLING 8 6:06 8 30 8 the haroy boys NANCY DREW AMERICAN TRAIL AMERICAN FOLK PAMTERS WASHINGTON WEEK IN REVIEW (R) THE GUITAR WITH NOAD FREDERICK Counting "Speeding Up (R 9 FESTIVAL OF B TURES 69 of O 8 THREE ffi AMERICAN QUARO TER HORSE SHOW WORLD M TOUCH ID MISTER ROGERS (9 SPEEDWAY 3:35 4:00 8 1:00 8 the secret spend Christmas Eve all alone when some very good friends help him discover the secret of Christmas. Arts Festival includes a profile report on a opera star. (R) MOVC "The Thin Man" (1934, 8 8 CHRISTMAS Captain Cutlass wonders why he must YOU: MAGAZINE FOR WOMEN STUDIO SEE Spole-t- o A visit to the Spoieto Baaketball: Guest: Billy AKERS many (R) 69 8 8 B8 PRESENTING Cabaret singer Karen Akers sings selections by Stephen Sondheim. Billy Joel and Jacques Brel m a performance from Hamburg, GerKAREN 8 8 TOWN-HAL- L 8 O Boat" B 8 ONCE UPON A CLASSIC "Black Island" ID MTERACTION O SCHOLASTIC SPORTS (9 Bottom LITTLE'S CAROL bust NO, HONESTLY) fl O 8 JAMES WATTS 69 BYU DEVOTIONAL KINGSTON OLYMPIAD MOVIE "Kramer Vs. THE WAYNE HOWARD'S COACH SHOW TENNIS "Davis Cup Finals: Singles Match C" from Cincinnati. Ohio. CHRISTMAS HERITAGE Edward Rowe, Oliver Jensen, Len Wood. Alistair Cooke and Scott Momaday look at Christmas customs in the U S. (R) MOVE "Why Would I La?" s 8 DEBOLTS GROW UP O HOUSTON RICH CEA NOTEBOOK WHAT WILL THEY THMKOFNEXT? MOVC "The ROBERT SCHULLER HAZEL REX HUMBARD KIDS ARE PEOPLE THE MUNSTERS CHRISTMAS playars. aa selected by the Football Writers Association ol America, are spotlighted. 700 CLUB KENNETH COPE- OS$e0MfUTE3 ffi STEPPING OUT: frightened to learn he has to have his tonsils out. O 0 CODE RED Danny a trapped m a blaring budding with gang members responsible tor setting a senes of fires. if TOUCH 0Eddieffi is JIMMY OUTDOORS ringmaster-host- O 8 NOVA O 8 (X) 1981 COLLEGE FOOTBALL TEAM Tha nation's tore-mo1981 collegiate toot-ba- ll Patera at tha Meadow-l- a nda Arana MOVIE "Kramer Va. Kramer" (1038, JEWISH and Brooke Shalds ere 2) AROfVES LACROSSE North Carolina vs U S. Team COUNTRY UNDERSEA OF JACQUES (1042, Elliott Gould, Bob Newhart boy who was transported back in time to ancient Egypt battles the evd general who has kidnapped King Tuf. (Pari Jungle Fantasy) H "Boys Dtama) VOICE tea-nito- Twenty-thre- screen and stage stars perform a variety of daring and humorous circus acts; Linda Evans. THROUGH THE MAGIC PYRAMID An B8 (1949, STARS 6008 BROADCAST BYU DEVOTIONAL 3:30 8 8p 2) Adventure) MOVC AFTERNOON O ON STAGE AT AGORA: EOOC MONEY tONGOOM "Valley Ol The EVEMNG MOVC 3.00 BASKET- COLLEGE BALL American OOWSKJHT 8 "Breaking (1080. Drama) 8 University vs Georgetown TIC 8 8 WIO Beavers" (Pari YES THE LAHA 8Book" 8Town" THECAROL AT ATRE A special producDickol tion tha Charles ens classic tala ia broadcast from tha histone Ford's Theatre in Washington. D C. (R) SCHOLASTIC SPORTS ACADEMY "Basketball: Passing" Guast: Billy Knight. ADVENTURES IN ROBERT CHURCH HOUR ffl HOTEL BALDERDASH BENHADEN SUNOAY MORN- MG ID MTERACTION ffl COLLEGE BASKETBALL Sat on HaH va. St. 2:30 CHRISTMAS MOVC 08NEWS nth the syndicate alter he framed m a narcotics a O before an operation aa thmge go from bad to worse (Part t) LARRY JONES at HUMAN (XMEN- StOH MOVC H "Rough BOA FORD'S O O EXTRA ALL M TK FAIRLY Archie teare tor his kte GREAT PERFOR- CROSSFVtE MOVIE Rib" "Adam'a f 8:00 8 O8 MANCES B 8 8Cut" (1980, ffi 80 (J Q 8 SCHULLER O 1:30 O U Den- Phils deiptua Eagles Dallas Cowboys MATMEE AT TTC TENNIS "Oavta Cup Fmala: Singles Matchaa C And D" horn Cincinnati. Ohio. MUSIC AND TIC C9 SPOKEN WORO GREATEST SPORTS LEGENDS "Elroy 'Crazy 6:30 soft Historical evidence is used to pace together a factual narrative ol the kte of one of civilization's most mftuentual individuals "The ffi MOVE Golden Raiders" (1970, Adventure) Roger Moore. David Nnen. An assorted group of people band together during World War 6 to escape from a camp and at the same time pul off an art heist CIRCUS OF THE "Man (1964, Comedy) Gregory Peck. MOVE A Million" With YOUR NEW BJAGE NFL FOOTBALL louts Cardtnals BCE OP 606 NFL FOOTBALL Seattle Sea hawks al ver Broncos 8 B 8 BUOU DC LESSON CD COLLEGE BALL Navada-La- a tooO THE O e 34lh Street" (1973. Comedy) Sebastian Cabot. David Hartman. An old man named Kris Krmgle is lured by Macy's to play Santa Claus m tha Thanksgiving Day parade. H "The MOVC 1:36 Outlaws Is Coming' On LONE RANGER EMERGENCY D. JAMES KEWED. NFL FOOTBALL New York Gama at St. CARTOONS IT IS WRITTEN 600 O O8M0VC"Mw-acl- lliams. A transplanted Southern lady aurvives on her memories of a more gentle past. 3:30 0 3:46 0 ANOTHER LIFE SHOWTIME'S HOLLY-WOO- ALL NIGHT PROGRAMMING NEWS 4:00 U.S. A.M. SHORTS BLOCK TO BE ANNOUNCED 4:30 VIVA SAN FERMIN 0 |